DNA Structure Generation Tutorial¶
Welcome to the DNA structure generation tutorial using the MDNA module. This notebook will guide you through various ways to generate and manipulate DNA structures. You'll learn to:
- Generate DNA sequences from scratch.
- Use custom sequences and define DNA topology to manipulate the linking number
- Apply custom shapes using control points
- Visualize and save DNA structures.
import numpy as np
import mdtraj as md
import matplotlib.pyplot as plt
import nglview as nv
import seaborn as sns
import mdna
Basic DNA Structure Generation¶
We start by generating a basic DNA structure using default settings, which outputs a DNA sequence known as the Drew Dickerson dodecamer.
# Build DNA with nothing, will output Drew Dickerson dodecamer DDD sequence
dna = mdna.make()
dna.describe()
Default sequence: CGCGAATTCGCG Number of base pairs: 12 Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 12 DNA structure with 12 base pairs Sequence: CGCGAATTCGCG Trajectory not loaded Frames: (12, 1, 4, 3)
view = nv.show_mdtraj(dna.get_traj().atom_slice(dna.get_traj().top.select('resid 1 22')))
view
NGLWidget()
Specifying a Sequence¶
You can specify a DNA sequence directly when generating the structure. Note, this will by default generate a linear strand of DNA.
# Or provide a sequence
dna = mdna.make(sequence='GCGCGCGCGC')
dna.describe()
Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 10 DNA structure with 10 base pairs Sequence: GCGCGCGCGC Trajectory not loaded Frames: (10, 1, 4, 3)
Generating DNA with Specific Base Pairs¶
Generate a DNA structure with a defined number of base pairs, resulting in a random sequence.
# Or provide a number of basepairs, resulting in a random sequence
dna = mdna.make(n_bp=10)
dna.describe()
Random sequence: CAAGTACTAT Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 10 DNA structure with 10 base pairs Sequence: CAAGTACTAT Trajectory not loaded Frames: (10, 1, 4, 3)
Creating Circular DNA Structures¶
Generate circular DNA structures, commonly known as minicircles.
# Or make a minicircle DNA in circular form
dna = mdna.make(n_bp=200, circular=True)
dna.draw()
print('Lk, Wr, Tw', dna.get_linking_number())
Random sequence: TCGGTACAAGTATCGTTAAGGCGTATGAGATTTAACGACCGACGGCTACACGATTTCTGCCTTGCCTTTGCATTTAACAATTAACGGGCCCAGCCATTAAGAAGCTCCCAAATGCTTATGTAGCGTATCGTATATTTGAATCTTGGTGGTCCCGAACCCACCATTACCAGAGCCTTTTCTGAAGAAGGCATGCCGTCAAT Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 200 Structure is requested to be circular: Excess twist per base to make ends meet: 1.71 degrees New twist angle per base pair: 36.0 using cython Lk, Wr, Tw [20. 0. 20.]
Minimizing the DNA structure¶
After generating the structure, you can minimize it to find a more energetically favorable conformation. The resulting structure is an idealized minicircle, however, if we can also minimize the DNA configuration using Monte Carlo (MC) simulations using a twistable worm like chain (TWLC) model of dsDNA.
# Let's also minimize the DNA configuration
dna.minimize()
# See the final configuration
dna.draw()
# Or save it to a file
dna.save_pdb('./pdbs/minimized_nbp_200_closed')
Minimize the DNA structure: simple equilibration = False equilibrate writhe = False excluded volume radius = 2.0 temperature = 300 Circular: True #################################### Initiating Excluded Volume... EV_bead mismatch: including additional boundary checks. ###################################### #### INITIALIZING EXCLUDED VOLUME #### ###################################### Excluded Volume Beads: number of EV beads: 29 bp per EV bead: 7 Effective size: 3.57 Exclusion distance: 4.0 ######################################
Modifying Linking Number¶
Change the linking number by underwinding or overwinding the DNA using the dLk parameter. Note, to equilibrate the writhe use equilibrate_writhe=True, otherwise the linking number of the topology will not be conserved.
# Also change the linking number by under or overwinding the DNA using the dLk parameter
dna = mdna.make(n_bp=200, circular=True, dLk=8)
dna.describe()
dna.get_linking_number()
# Minimize the DNA configuration,
dna.minimize(equilibrate_writhe=True)
dna.get_linking_number()
Random sequence: CTTGTTTCTGCGAGGCAGGACAACCTCTCTCGACGTCATCGGCCACAGCGCTCTGGCCTGGCGGCAAATCAACGAGCCCATCTCCCCTTGACGTAGTACTATCGATCAATAAAGTGTTCCTATACAATATTTGCAGCCAATCGATTGATATCTGGCGCATGCAATCCCCATCATGTTGCAGGCCTGATCCATCACGTGAG Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 200 Structure is requested to be circular: Excess twist per base to make ends meet: 1.71 degrees New twist angle per base pair: 36.0 Adjusting twist to match ΔLk = 8 Current twist number (Tw₀): 20.00 Computed writhe (Wr): 0.00 Target twist number (Tw): 28.00 Resulting Lk = Tw + Wr: 28.00 Old twist angle per bp: 36.00° New twist angle per bp: 50.40° Circular DNA structure with 200 base pairs Sequence: CTTGTTTCTGCGAGGCAGGACAACCTCTCTCGACGTCATCGGCCACAGCGCTCTGGCCTGGCGGCAAATCAACGAGCCCATCTCCCCTTGACGTAGTACTATCGATCAATAAAGTGTTCCTATACAATATTTGCAGCCAATCGATTGATATCTGGCGCATGCAATCCCCATCATGTTGCAGGCCTGATCCATCACGTGAG Trajectory not loaded Frames: (200, 1, 4, 3) using cython Minimize the DNA structure: simple equilibration = False equilibrate writhe = True excluded volume radius = 2.0 temperature = 300 Circular: True #################################### Initiating Excluded Volume... EV_bead mismatch: including additional boundary checks. ###################################### #### INITIALIZING EXCLUDED VOLUME #### ###################################### Excluded Volume Beads: number of EV beads: 29 bp per EV bead: 7 Effective size: 3.57 Exclusion distance: 4.0 ###################################### E1 = 1593.49 kT E2 = 1412.36 kT wr_equi=False wr1 = 1.34 wr2 = 2.31 E = 1410.96 kT E_num_below=0 wr = 2.31 wr_num_below=0 E = 1395.85 kT E_num_below=0 wr = 2.21 wr_num_below=1 E = 1408.11 kT E_num_below=1 wr = 2.09 wr_num_below=2 E = 1403.29 kT E_num_below=2 wr = 2.23 wr_num_below=3 E = 1415.90 kT E_num_below=3 using cython
array([28. , 2.39639374, 25.60360626])
Visualizing DNA Minimization¶
Use NGLview to visualize molecular dynamics and in our case the results of Monte Carlo minimization.
# visualize using nglview MC minimization
mc_traj = dna.get_MC_traj()
view = nv.show_mdtraj(mc_traj)
view.clear()
view.add_ball_and_stick()
view
NGLWidget(max_frame=780)
Using Custom Shapes¶
Explore the use of custom shapes for DNA structures through control points, allowing complex configurations. The Shapes class contains many predefined parametric functions that describe common shapes in 3D space. Utilize custom shapes for DNA structure generation, including helical shapes and more.
# We can also use custom shapes using the Shape class
control_points = mdna.Shapes.helix(height=3, pitch=5, radius=7, num_turns=4)
dna = mdna.make(n_bp=300, control_points=control_points)
dna.draw()
Random sequence: ACGGGCTGACCGCCTTCGCATGAAAAATCAGTTATCTGCCGGTCGATATGGGCGTATGGTAAGTTGACCCCCTCGGCTCCCGGAGCTACGGGGCGCTCTTCACGCGTAACTCCCTGCTTTTCACGCGGGGGCTGCATATAGATAAGATCTAAAGGACAGTCAGGACGACATAGGTAGTTCAGGAGTTCGCTCTTCTTTCCCGTATAGTTCCAGTAACAGTTGAGTGCAATATCCGCAAACGAGTATTACTGAGGGCGATGAGTATGTACTTAAACCGCCCAGGTCGATAATAACCGGTCG Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 300
Defining Complex Custom Shapes¶
Define intricate shapes by specifying control points manually. The points are used to fit a B-spline that goes through each of these points. Note, the minimum number of control_points to fit a spline through is 4.
# Or use the control points to define a custom shape
control_points = np.array([[0,0,0],[30,10,-10],[50,10,20],[20,4,60]])
dna = mdna.make(n_bp=100, control_points=control_points, sequence=['A']*100)
dna.draw()
dna.describe()
dna.sequence
Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 100 DNA structure with 100 base pairs Sequence: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Trajectory: <mdtraj.Trajectory with 1 frames, 4100 atoms, 200 residues, without unitcells> Frames: (100, 1, 4, 3)
'AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA'
Extending DNA Sequences¶
We can use the custom shaped DNA structure to learn how to extend DNA sequences from both ends. By default the minimization is on using the .extend() function.
# We can also extend our DNA
dna.extend(sequence=['G']*40)
# Or extend it in the opposite direction
dna.extend(sequence=['C']*40, forward=False)
dna.draw()
Minimize the DNA structure: simple equilibration = False equilibrate writhe = False excluded volume radius = 2.0 temperature = 300 Circular: False #################################### Initiating Excluded Volume... ###################################### #### INITIALIZING EXCLUDED VOLUME #### ###################################### Excluded Volume Beads: number of EV beads: 20 bp per EV bead: 7 Effective size: 3.573 Exclusion distance: 4.0 ###################################### Minimize the DNA structure: simple equilibration = False equilibrate writhe = False excluded volume radius = 2.0 temperature = 300 Circular: False #################################### Initiating Excluded Volume... ###################################### #### INITIALIZING EXCLUDED VOLUME #### ###################################### Excluded Volume Beads: number of EV beads: 26 bp per EV bead: 7 Effective size: 3.593 Exclusion distance: 4.0 ######################################
Connecting Two DNA Strands¶
Connect two separate DNA strands and visualize the configuration. This function will find the optimal number of basepairs to connect the two strands to minimize the twist. Alternatively you can also pass the n_bp or control_points.
# Lets generate two strands of DNA and displace the second one away from the first one
dna0 = mdna.make(sequence='AAAAAAAAA', control_points=mdna.Shapes.line(1))
dna1 = mdna.make(sequence='GGGGGGGGG', control_points=mdna.Shapes.line(1)+np.array([4,0,-5]))
# Now we can connect the two strands
dna2 = mdna.connect(dna0, dna1)
dna2.draw()
dna2.describe()
Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 9 Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 9 Optimal BP: 54, Twist Difference per BP: 0.002 degrees Optimal number of base pairs: 54 Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 56 Random sequence: ATTATTGGTCCTGCGTACATCTGCATATCCCCGCATGAGCGGGGGGCCGACGGC Minimize the DNA structure: simple equilibration = False equilibrate writhe = False excluded volume radius = 0.0 temperature = 300 Circular: False DNA structure with 72 base pairs Sequence: AAAAAAAAAATTATTGGTCCTGCGTACATCTGCATATCCCCGCATGAGCGGGGGGCCGACGGCGGGGGGGGG Trajectory: <mdtraj.Trajectory with 1 frames, 2952 atoms, 144 residues, without unitcells> Frames: (72, 1, 4, 3)
Understanding make() Decision Logic¶
The behavior of mdna.make() depends on which inputs are provided (sequence, n_bp, control_points, circular).
The next cells run a set of representative scenarios and visualize how those inputs resolve into the final DNA object.
For control_points-only input (sequence=None, n_bp=None), the number of base pairs is inferred from the spline/frame spacing (shape-dependent), not from the default dodecamer.
Scenarios include:
- default call (no inputs)
- sequence only
- n_bp only
- control points only (infer
n_bp) - control points + sequence
- control points +
n_bp - matching
sequence+n_bp - circular template
- mismatched
sequence+n_bp(expected error)
# Decision-matrix scenarios for mdna.make()
import pandas as pd
control_points_demo = np.array([
[0.0, 0.0, 0.0],
[0.5, 0.2, 0.2],
[1.0, 0.4, 0.0],
[1.5, 0.0, -0.2],
])*10
scenarios = [
('default', {}),
('sequence_only', {'sequence': 'GCGCGCGCGC'}),
('n_bp_only', {'n_bp': 14}),
('control_points_only', {'control_points': control_points_demo}),
('control_points_sequence', {'control_points': control_points_demo, 'sequence': 'ATGCATGCATGC'}),
('control_points_n_bp', {'control_points': control_points_demo, 'n_bp': 18}),
('sequence_n_bp_match', {'sequence': 'ATGCATGC', 'n_bp': 8}),
('circular_template', {'n_bp': 24, 'circular': True}),
('sequence_n_bp_mismatch', {'sequence': 'ATGC', 'n_bp': 6}),
]
rows = []
for label, kwargs in scenarios:
row = {
'scenario': label,
'has_sequence': int('sequence' in kwargs and kwargs['sequence'] is not None),
'has_n_bp': int('n_bp' in kwargs and kwargs['n_bp'] is not None),
'has_control_points': int('control_points' in kwargs and kwargs['control_points'] is not None),
'circular': int(kwargs.get('circular', False)),
}
try:
dna_case = mdna.make(**kwargs)
row.update({
'status': 'ok',
'resolved_n_bp': dna_case.n_bp,
'sequence_len': len(dna_case.sequence),
'resolved_circular': int(dna_case.circular),
})
except Exception as exc:
row.update({
'status': f'error: {type(exc).__name__}',
'resolved_n_bp': np.nan,
'sequence_len': np.nan,
'resolved_circular': np.nan,
})
rows.append(row)
decision_df = pd.DataFrame(rows)
decision_df
Default sequence: CGCGAATTCGCG Number of base pairs: 12 Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 12 Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 10 Random sequence: TGGGACTGAGATTT Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 14 Random sequence: GTTGATGAGGCACTGCTCGCCTAGCCTAGGTCTGTTCACCGCTAGCGCCATTATCCG Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 12 Random sequence: AAGGTACCTTGCGACGTG Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 18 Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 8 Random sequence: ATTTCGGTCAATCGTTCTGGGATT Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 24 Structure is requested to be circular: Excess twist per base to make ends meet: 10.71 degrees New twist angle per base pair: 45.0
| scenario | has_sequence | has_n_bp | has_control_points | circular | status | resolved_n_bp | sequence_len | resolved_circular | |
|---|---|---|---|---|---|---|---|---|---|
| 0 | default | 0 | 0 | 0 | 0 | ok | 12.0 | 12.0 | 0.0 |
| 1 | sequence_only | 1 | 0 | 0 | 0 | ok | 10.0 | 10.0 | 0.0 |
| 2 | n_bp_only | 0 | 1 | 0 | 0 | ok | 14.0 | 14.0 | 0.0 |
| 3 | control_points_only | 0 | 0 | 1 | 0 | ok | 57.0 | 57.0 | 0.0 |
| 4 | control_points_sequence | 1 | 0 | 1 | 0 | ok | 12.0 | 12.0 | 0.0 |
| 5 | control_points_n_bp | 0 | 1 | 1 | 0 | ok | 18.0 | 18.0 | 0.0 |
| 6 | sequence_n_bp_match | 1 | 1 | 0 | 0 | ok | 8.0 | 8.0 | 0.0 |
| 7 | circular_template | 0 | 1 | 0 | 1 | ok | 24.0 | 24.0 | 1.0 |
| 8 | sequence_n_bp_mismatch | 1 | 1 | 0 | 0 | error: ValueError | NaN | NaN | NaN |
# Visualize inputs -> outcomes for make() scenarios
input_cols = ['has_sequence', 'has_n_bp', 'has_control_points', 'circular']
fig, axes = plt.subplots(1, 2, figsize=(12, 4), gridspec_kw={'width_ratios': [1.2, 1]})
# Left: input decision matrix
sns.heatmap(
decision_df[input_cols],
ax=axes[0],
cmap='Blues',
cbar=False,
linewidths=0.5,
linecolor='white',
annot=True,
fmt='.0f',
yticklabels=decision_df['scenario']
)
axes[0].set_title('Input flags per scenario')
axes[0].set_xlabel('input provided')
axes[0].set_ylabel('scenario')
# Right: resolved size and status
resolved = decision_df.copy()
ok_mask = resolved['status'].eq('ok')
x = np.arange(len(resolved))
axes[1].bar(x[ok_mask], resolved.loc[ok_mask, 'resolved_n_bp'], color='tab:green', alpha=0.8, label='resolved_n_bp')
if (~ok_mask).any():
axes[1].scatter(x[~ok_mask], np.zeros((~ok_mask).sum()), color='tab:red', marker='x', s=80, label='error')
axes[1].plot(x[ok_mask], resolved.loc[ok_mask, 'sequence_len'], 'o', color='tab:orange', label='sequence_len')
axes[1].set_xticks(x)
axes[1].set_xticklabels(resolved['scenario'], rotation=45, ha='right')
axes[1].set_ylabel('base pairs')
axes[1].set_title('Resolved outputs')
axes[1].legend(frameon=False)
fig.tight_layout()
decision_df[['scenario', 'status', 'resolved_n_bp', 'sequence_len', 'resolved_circular']]
| scenario | status | resolved_n_bp | sequence_len | resolved_circular | |
|---|---|---|---|---|---|
| 0 | default | ok | 12.0 | 12.0 | 0.0 |
| 1 | sequence_only | ok | 10.0 | 10.0 | 0.0 |
| 2 | n_bp_only | ok | 14.0 | 14.0 | 0.0 |
| 3 | control_points_only | ok | 57.0 | 57.0 | 0.0 |
| 4 | control_points_sequence | ok | 12.0 | 12.0 | 0.0 |
| 5 | control_points_n_bp | ok | 18.0 | 18.0 | 0.0 |
| 6 | sequence_n_bp_match | ok | 8.0 | 8.0 | 0.0 |
| 7 | circular_template | ok | 24.0 | 24.0 | 1.0 |
| 8 | sequence_n_bp_mismatch | error: ValueError | NaN | NaN | NaN |
Molecular visualization of make() decision outcomes¶
Use the selector below to interactively compare 3D structures produced by different make() input combinations.
This makes it easier to connect the decision matrix to actual structural outcomes.
# Interactive molecular viewer for representative make() scenarios
import ipywidgets as widgets
from IPython.display import display
viz_scenarios = {
'default': {},
'sequence_only': {'sequence': 'GCGCGCGCGC'},
'n_bp_only': {'n_bp': 14},
'control_points_only': {'control_points': control_points_demo},
'control_points + sequence': {'control_points': control_points_demo, 'sequence': 'ATGCATGCATGC'},
'control_points + n_bp': {'control_points': control_points_demo, 'n_bp': 18},
'circular_template': {'n_bp': 24, 'circular': True},
}
viz_dna = {name: mdna.make(**kwargs) for name, kwargs in viz_scenarios.items()}
selector = widgets.Dropdown(
options=list(viz_dna.keys()),
value='default',
description='scenario:',
layout=widgets.Layout(width='420px')
)
out = widgets.Output()
def render_case(change=None):
with out:
out.clear_output(wait=True)
case_name = selector.value
dna_case = viz_dna[case_name]
traj_case = dna_case.get_traj()
view_case = nv.show_mdtraj(traj_case)
view_case.clear_representations()
view_case.add_cartoon(color='residueindex')
view_case.add_licorice()
display(view_case)
print(f"scenario={case_name} | n_bp={dna_case.n_bp} | circular={dna_case.circular} | sequence_length={len(dna_case.sequence)}")
selector.observe(render_case, names='value')
render_case()
widgets.VBox([selector, out])
Default sequence: CGCGAATTCGCG Number of base pairs: 12 Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 12 Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 10 Random sequence: GGTGCTGTGTACTC Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 14 Random sequence: TCGATTCCCAGCGAAAGCAGTCATGATAAGCAACCATAGTATTCCACTTCTTATCCC Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 12 Random sequence: TCCAACGATCAGGAACAT Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 18 Random sequence: AAAGGCCAAATTTACACTGTTTGC Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 24 Structure is requested to be circular: Excess twist per base to make ends meet: 10.71 degrees New twist angle per base pair: 45.0