Structure Generation Tutorial¶
Welcome to the DNA structure generation tutorial using the MDNA module. This notebook will guide you through various ways to generate and manipulate DNA structures. You'll learn to:
- Generate DNA sequences from scratch.
- Use custom sequences and define DNA topology to manipulate the linking number
- Apply custom shapes using control points
- Visualize and save DNA structures.
import numpy as np
import mdtraj as md
import matplotlib.pyplot as plt
import nglview as nv
import seaborn as sns
import mdna
%
Basic DNA Structure Generation¶
We start by generating a basic DNA structure using default settings, which outputs a DNA sequence known as the Drew Dickerson dodecamer.
# Build DNA with nothing, will output Drew Dickerson dodecamer DDD sequence
dna = mdna.make()
dna.describe()
Specifying a Sequence¶
You can specify a DNA sequence directly when generating the structure. Note, this will by default generate a linear strand of DNA.
# Or provide a sequence
dna = mdna.make(sequence='GCGCGCGCGC')
dna.describe()
Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 10 DNA structure with 10 base pairs Sequence: GCGCGCGCGC Trajectory not loaded Frames: (10, 1, 4, 3)
Generating DNA with Specific Base Pairs¶
Generate a DNA structure with a defined number of base pairs, resulting in a random sequence.
# Or provide a number of basepairs, resulting in a random sequence
dna = mdna.make(n_bp=10)
dna.describe()
Random sequence: GCACCCGCCA Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 10 DNA structure with 10 base pairs Sequence: GCACCCGCCA Trajectory not loaded Frames: (10, 1, 4, 3)
Creating Circular DNA Structures¶
Generate circular DNA structures, commonly known as minicircles.
# Or make a minicircle DNA in circular form
dna = mdna.make(n_bp=200, circular=True)
print('Lk, Wr, Tw', dna.get_linking_number())
dna.draw()
Minimizing the DNA structure¶
After generating the structure, you can minimize it to find a more energetically favorable conformation. The resulting structure is an idealized minicircle, however, if we can also minimize the DNA configuration using Monte Carlo (MC) simulations using a twistable worm like chain (TWLC) model of dsDNA.
# Let's also minimize the DNA configuration
dna.minimize()
# See the final configuration
dna.draw()
# Or save it to a file
dna.save_pdb('./pdbs/minimized_nbp_200_closed.pdb')
Minimize the DNA structure: simple equilibration = False equilibrate writhe = False excluded volume radius = 2.0 temperature = 300 Circular: False #################################### Initiating Excluded Volume... ###################################### #### INITIALIZING EXCLUDED VOLUME #### ###################################### Excluded Volume Beads: number of EV beads: 2 bp per EV bead: 7 Effective size: 3.574 Exclusion distance: 4.0 ######################################
Modifying Linking Number¶
Change the linking number by underwinding or overwinding the DNA using the dLk parameter. Note, to equilibrate the writhe use equilibrate_writhe=True, otherwise the linking number of the topology will not be conserved.
# Also change the linking number by under or overwinding the DNA using the dLk parameter
dna = mdna.make(n_bp=200, circular=True, dLk=8)
dna.describe()
dna.get_linking_number()
# Minimize the DNA configuration,
dna.minimize(equilibrate_writhe=True)
dna.get_linking_number()
Random sequence: GTGTCCAATGATTAGGGTGGTCGATTTGAATTCATTAGGGCCTTCCGATCTCCGGCGTTCTGTGAAGCAGGTGCCGATCCAGACGCCCTGGTGAAGCAGACCGTGGTAACCGGTTCATTTCCATTCCGGCTCCAGATGAAACTCGCTTTTCGCGGCCTGGATGGAACACAGATCTGTGTCCTGCTCCGCGAACCGCAATT Start rescaling spline based on requested number of base pairs. This requires recomputation of the control points to match the desired number of base pairs. Spline scaled to match the target number of base pairs: 200 Structure is requested to be circular: Excess twist per base to make ends meet: 1.71 degrees New twist angle per base pair: 36.0 Adjusting twist angles to match the given Delta linking number: 8 Current twist number: 20.00 Old twist angle per base pair: 36.00 degrees Adjusted twist angle per base pair: 50.40 degrees Circular DNA structure with 200 base pairs Sequence: GTGTCCAATGATTAGGGTGGTCGATTTGAATTCATTAGGGCCTTCCGATCTCCGGCGTTCTGTGAAGCAGGTGCCGATCCAGACGCCCTGGTGAAGCAGACCGTGGTAACCGGTTCATTTCCATTCCGGCTCCAGATGAAACTCGCTTTTCGCGGCCTGGATGGAACACAGATCTGTGTCCTGCTCCGCGAACCGCAATT Trajectory not loaded Frames: (200, 1, 4, 3) using numba Minimize the DNA structure: simple equilibration = False equilibrate writhe = True excluded volume radius = 2.0 temperature = 300 Circular: True #################################### Initiating Excluded Volume... EV_bead mismatch: including additional boundary checks. ###################################### #### INITIALIZING EXCLUDED VOLUME #### ###################################### Excluded Volume Beads: number of EV beads: 29 bp per EV bead: 7 Effective size: 3.57 Exclusion distance: 4.0 ###################################### E1 = 1595.65 kT E2 = 1418.14 kT wr_equi=False wr1 = 1.25 wr2 = 2.17 E = 1428.40 kT E_num_below=1 wr = 2.17 wr_num_below=1 E = 1435.66 kT E_num_below=2 wr = 2.14 wr_num_below=2 E = 1392.74 kT E_num_below=0 wr = 2.15 wr_num_below=3 E = 1416.21 kT E_num_below=1 E = 1446.37 kT E_num_below=2 E = 1383.02 kT E_num_below=0 E = 1391.69 kT E_num_below=1 E = 1390.11 kT E_num_below=2 E = 1390.31 kT E_num_below=3 using numba
array([28. , 2.34476608, 25.65523392])
mc = dna.get_MC_traj()
view = nv.show_mdtraj(mc)
view
NGLWidget(max_frame=1020)
Using Custom Shapes¶
Explore the use of custom shapes for DNA structures through control points, allowing complex configurations. The Shapes class contains many predefined parametric functions that describe common shapes in 3D space. Utilize custom shapes for DNA structure generation, including helical shapes and more.
# We can also use custom shapes using the Shape class
control_points = mdna.Shapes.helix(height=3, pitch=5, radius=7, num_turns=4)
dna = mdna.make(n_bp=300, control_points=control_points)
dna.draw()
Defining Complex Custom Shapes¶
Define intricate shapes by specifying control points manually. The points are used to fit a B-spline that goes through each of these points. Note, the minimum number of control_points to fit a spline through is 4.
# Or use the control points to define a custom shape
control_points = np.array([[0,0,0],[30,10,-10],[50,10,20],[20,4,60]])
dna = mdna.make(n_bp=100, control_points=control_points, sequence=['A']*100)
dna.draw()
dna.describe()
dna.sequence
Extending DNA Sequences¶
We can use the custom shaped DNA structure to learn how to extend DNA sequences from both ends. By default the minimization is on using the .extend() function.
# We can also extend our DNA
dna.extend(sequence=['G']*40)
# Or extend it in the opposite direction
dna.extend(sequence=['C']*40, forward=False)
dna.draw()
Connecting Two DNA Strands¶
Connect two separate DNA strands and visualize the configuration. This function will find the optimal number of basepairs to connect the two strands to minimize the twist. Alternatively you can also pass the n_bp or control_points.
# Lets generate two strands of DNA and displace the second one away from the first one
dna0 = mdna.make(sequence='AAAAAAAAA', control_points=mdna.Shapes.line(1))
dna1 = mdna.make(sequence='GGGGGGGGG', control_points=mdna.Shapes.line(1)+np.array([4,0,-5]))
# Now we can connect the two strands
dna2 = mdna.connect(dna0, dna1)
dna2.draw()
dna2.describe()
Visualizing DNA Minimization¶
Use NGLview to visualize molecular dynamics and the results of Monte Carlo minimization.
# visualize using nglview MC minimization
view = nv.show_mdtraj(dna2.get_MC_traj())
view